# nhmmer :: search a DNA model or alignment against a DNA database # HMMER 3.1 (February 2013); http://hmmer.org/ # Copyright (C) 2011 Howard Hughes Medical Institute. # Freely distributed under the GNU General Public License (GPLv3). # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - # query HMM file: MADE1.hmm # target sequence database: dna_target.fa # hits tabular output: MADE1.tblout # number of worker threads: 2 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - Query: MADE1 [M=80] Accession: DF0000629.2 Description: MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon Scores for complete hits: E-value score bias Sequence start end Description ------- ------ ----- -------- ----- ----- ----------- 8.4e-11 39.0 7.4 humanchr1/239220001-239550000 302390 302466 7.8e-08 29.5 6.0 humanchr1/239220001-239550000 302466 302390 8.4e-08 29.4 8.3 humanchr1/239220001-239550000 174456 174498 5.6e-06 23.6 7.0 humanchr1/239220001-239550000 174493 174456 ------ inclusion threshold ------ 1.7 6.0 6.7 humanchr1/239220001-239550000 304074 304104 Annotation for each hit (and alignments): >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- ! 39.0 7.4 8.4e-11 4 80 .] 302390 302466 .. 302387 302466 .. 330000 0.87 Alignment: score: 39.0 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcacc 73 ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc a aaa g a t ctttt cacc humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GTA-ATGCTTTTACACC 302459 899******************************************955533.443..334.4689********* PP xxxxxxx RF MADE1 74 aacctaa 80 aa ctaa humanchr1/239220001-239550000 302460 AATCTAA 302466 **99986 PP >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- ! 29.5 6.0 7.8e-08 1 77 [. 302466 302390 .. 302466 302387 .. 330000 0.74 Alignment: score: 29.5 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxx RF MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgc 58 ttag ttggtg aaaag cattactttt aatggcaaaaacc c humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCAC 302409 68899999999999998................5667777776222222222222222268************* PP xxxxxxxxxxxxxxxxxxx RF MADE1 59 aattacttttgcaccaacc 77 aatt ttttgcacc acc humanchr1/239220001-239550000 302408 AATTGATTTTGCACCGACC 302390 ***************9998 PP >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- ! 29.4 8.3 8.4e-08 1 43 [. 174456 174498 .. 174456 174518 .. 330000 0.93 Alignment: score: 29.4 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 ttaggtt gtgcaaaagtaattg ggtttttg cattactttt humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498 589************************************9975 PP >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- ! 23.6 7.0 5.6e-06 43 80 .] 174493 174456 .. 174513 174456 .. 330000 0.93 Alignment: score: 23.6 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80 taatg caaaaacc caattacttttgcac aacctaa humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456 689********************************985 PP >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- ? 6.0 6.7 1.7 42 72 .. 304074 304104 .. 304053 304109 .. 330000 0.87 Alignment: score: 6.0 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 42 ttaatggcaaaaaccgcaattacttttgcac 72 t a tgg aaaaa ca tta ttttgca humanchr1/239220001-239550000 304074 TAAGTGGGAAAAAATACACTTATTTTTGCAT 304104 55779************************85 PP Internal pipeline statistics summary: ------------------------------------- Query model(s): 1 (80 nodes) Target sequences: 1 (660000 residues searched) Residues passing SSV filter: 61658 (0.0934); expected (0.02) Residues passing bias filter: 45802 (0.0694); expected (0.02) Residues passing Vit filter: 2443 (0.0037); expected (0.001) Residues passing Fwd filter: 2217 (0.00336); expected (1e-05) Total number of hits: 5 (0.000403) # CPU time: 0.05u 0.01s 00:00:00.06 Elapsed: 00:00:00.33 # Mc/sec: 160.00 // [ok]